Ion Torrent does the Samba

I'm a bit behind the curve here (see Lex's blog post from July 2011), but I was amused to find out Ion Torrent call their current nucleotide flow order TACGTACGTCTGAGCATCGATCGATGTACAGC the "Samba". Apparently the idea is to avoid reads going out of phase which could happen with the traditional repeated flow TACG (still used by Roche 454), by giving the molecules which missed a base a chance to catch up, and for IonTorrent this works better.

I wonder if the flow order next revision will also get a dance based name? I'd suggest conga, since it is about synchronising lots of people.

If I Google for TACGTACGTCTGAGCATCGATCGATGTACAGC it mostly shows up in PDF IonTorrent output reports. In addition to Lex's blog post I also found on the sequence mentioned on Monkol Lek's blog as the Ion Torrent flow order in an example command line, and in the comments of this French blog post about Sequencing E. coli in 3 days on the Ion Torrent PGM.

Ion Torrent can't have been the first to think about altering the flow order because the SFF file format itself defines this in the header structure (meaning the designers expected it to change). You can spot the difference between Roche 454 and older Ion Torrent data, versus newer Ion Torrent data using, using something like sffinfo (from the Roche off-instrument application suite) or Biopython to look at the SFF file.

As an example, I've got Roche 454 SFF files with 400 or 800 flows, they simply repeat TACG 100 or 200 times:

TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACG

Early Ion Torrent SFF files were similar (but with less flows - see here for an example).

On the other hand, in Ion Torrent SFF tests file a collaborator sent me from May 2011 and in E_coli_O104H4_SFF.zip (see Ion Torrent document 1621 which should be freely downloadable), there were 260 flows, consisting of their "Samba" sequence TACGTACGTCTGAGCATCGATCGATGTACAGC repeated eight and a bit times:

TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC

Interesting. Well, interesting to (some) sequencing geeks anyway.