Good news - the Ion Torrent Suite is now freely available open source software on GitHub under the GPL v2 licence, as promised late last year. There is now something more substantial behind talk of Ion Torrent "democratising sequencing", and a clear advantage over the closed source tools of rival companies. I commend them!
Bioinformatics lessons learned the hard way, bugs, gripes, and maybe topical paper reviews too...
2012-01-23
2012-01-16
Ion Torrent does the Samba
I'm a bit behind the curve here (see Lex's blog post from July 2011), but I was amused to find out Ion Torrent call their current nucleotide flow order
I wonder if the flow order next revision will also get a dance based name? I'd suggest conga, since it is about synchronising lots of people.
TACGTACGTCTGAGCATCGATCGATGTACAGC the "Samba". Apparently the idea is to avoid reads going out of phase which could happen with the traditional repeated flow TACG (still used by Roche 454), by giving the molecules which missed a base a chance to catch up, and for IonTorrent this works better.I wonder if the flow order next revision will also get a dance based name? I'd suggest conga, since it is about synchronising lots of people.
Subscribe to:
Posts (Atom)